The objective of this study was to elucidate the role and molecular mechanisms of lactate-mediated histone lactylation in regulating macrophage M1 polarization in AAA. We validated the regulation of histone lactylation and macrophage M1 polarization by lactate through cellular and animal experiments. By integrating transcriptomic sequencing and H3K18la cleavage under target & tagmentation (CUT&Tag), we identified key genes involved in regulating AAA and exhibited high histone lactylation modification. This study establishes a theoretical foundation for the development of drugs and clinical interventions targeting AAA.
Histone lactylation was elevated in M1 macrophages of AAA
To explore the impact of lactylation modification on the regulation of AAA, we collected serum samples from AAA patients and healthy volunteers and measured lactate levels. The results showed a notable elevation in serum lactate levels among AAA patients in comparison to the control group (Fig. 1A). The receiver operating characteristic (ROC) curve was constructed for lactate, which revealed an area under the curve (AUC) of 0.8485 (P = 0.0088). The diagnostic performance of lactate for AAA was characterized by a sensitivity of 88.89% and a specificity of 72.73% (Fig. 1B). Based on these results, it can be inferred that lactate has the potential to function as a diagnostic biomarker for AAA. To further investigate whether histone lactylation is increased in AAA, we established an AAA mouse model by injection of Ang II. The AAA group exhibited a significant elevation in the maximum arterial diameter compared to the control group (Fig. 1C, D). Histopathological changes were examined using H&E, EVG, and Masson's trichrome staining. Compared with the NC group, mice in the AAA group exhibited marked abdominal aortic dilation, reduced collagen content, and increased fragmentation of elastic fibers (Fig. 1E-G). Furthermore, we assessed the histone lactylation level and the expression of the M1 macrophage marker CD86 in abdominal aortic tissue. The IF analysis revealed upregulated levels of H3K18la and increased CD86 expression in the AAA group, and H3K18la co-localized with CD86 in the aortic aneurysm, suggesting both an expansion of M1 macrophages and enhanced H3K18la levels within these M1 macrophages during AAA pathogenesis (Fig. 1H). These results suggeste that lactate levels are elevated in AAA and that there is an upregulation of histone lactylation levels in M1 macrophages.
Lactate induces histone lactylation modification and M1 polarization in macrophages
We conducted cellular experiments to validate the induction of macrophage M1 polarization and histone lactylation by lactate in AAA. THP-1 cells were stimulated with PMA in vitro to induce their differentiation into macrophages, followed by lactate treatment. We assessed the level of H3K18la in the cells through WB, and the results revealed a significant increase in H3K18la modification after lactate treatment (Fig. 2A). The expression levels of polarization markers were examined, and the RT-qPCR results demonstrated a significant upregulation of M1 markers CD80, MCP-1, and iNOS in the lactate-treated group (Fig. 2B), while the M2 marker CD163 was significantly downregulated, and there were no significant changes observed in MRC-2 and Arg-1 (Fig. 2C). The levels of inflammatory cytokines were measured using ELISA, and we found that lactate treatment significantly upregulated TNF-α and IL-1β levels, while IL-10 was significantly downregulated (Fig. 2D). IF of macrophage polarization markers revealed an upregulation of the M1 marker CD86 after lactate treatment (Fig. 2E), while the M2 polarization marker CD206 was downregulated (Fig. 2F). These findings suggeste that lactate induces histone lactylation and macrophage M1 polarization.
Transcriptome sequencing reveals dysregulated gene expression in lactate-treated macrophages
To elucidate the underlying molecular mechanisms of lactate regulation of M1 polarization in macrophages, we collected PBMCs from healthy human blood. PBMCs were induced into macrophages using M-CSF and incubated with lactate (10 mM). Subsequently, transcriptome sequencing was performed on lactate-treated and untreated macrophages. The results revealed a total of 18,725 genes that were successfully mapped, among which 305 genes exhibited differential expression. In comparison to the control group, the lactate-treated group exhibited an increase in the expression of 167 genes and a decrease in the expression of 138 genes (|log2FC | > 1, FDR < 0.05) (Fig. 3A, B). GO analysis of the DEGs indicated their enrichment in GO terms such as type I interferon signaling pathway, immune system processes, and cytokine-mediated signaling pathway (Fig. 3C). Pathway analysis further revealed that the DEGs were enriched in pathways including the NOD-like receptor signaling pathway and Chemokine signaling pathway (Fig. 3D). These results indicate that there is dysregulation of transcriptional expression in lactate-treated macrophages.
CUT&Tag reveals abnormal histone lactylation modification in lactate-treated macrophages
To determine the changes in histone lactylation in AAA, we collected PBMCs from the blood of healthy individuals and induced PBMCs into macrophages using M-CSF, followed by treatment with lactate (10 mM). The macrophages were subjected to CUT&Tag using H3K18la antibody. We found that the enrichment of the H3K18la peak was increased in lactate-treated macrophages compared to controls (Fig. 4A). Motif analysis of all histone lactylation modification peaks showed that the predominant motif of the control group was CTCCxCCTCCxGGGTTCAAGCGATTCTCCTGCCTCAGCCTC, while the predominant motif in the lactate-treated group was CCTCxGCCTCCCAAAGTGCTGGGATTACAGGCGTGAGCC (Fig. 4B). Furthermore, we observed differences in histone lactylation modification peaks between the lactate-treated group and the control group (Fig. 4C). A total of 209 peaks were identified as common peaks. The control group had 5187 unique peaks, and the lactate group had 6464 unique peaks (Fig. 4D, up). Among the genes associated with the modified peaks, 757 genes were identified as common genes. The control group had 2025 unique genes, and the lactate group had 2505 unique genes (Fig. 4D, down). Next, we identified differential peaks of lactylation modification following lactate treatment. The results revealed 839 differential peaks, with 195 peaks enhanced and 644 peaks weakened (|M.value | > 1, P < 0.03) (Fig. 4E). GO analysis of the genes with upregulated histone lactylation levels revealed their involvement in the regulation of adaptive immune response and activation of immune response (Fig. 4F). KEGG revealed an enrichment of genes with increased histone lactylation in pathways such as Hedgehog signaling pathway, Autophagy-animal, and Wnt signaling pathway (Fig. 4G). These data indicate that there is an abnormal landscape of histone lactylation modification in macrophages after lactate treatment.
CUT&Tag and transcriptome sequencing identify COL27A1, SLFNL1, GLI3, SEMA5A, and RPS3AP5 as key genes regulated by histone lactylation modification in macrophages
Next, we further identify the key target genes mediated by lactylation modification in lactate-treated macrophages. Given that histone lactylation is upregulated in lactate-treated macrophages, and it has been shown that lactylation promotes transcriptional activation of genes [15], we intersected the upregulated DEGs from transcriptome sequencing and the genes exhibiting high lactylation modification in CUT&Tag. A total of five intersected genes were obtained, including COL27A1, SLFNL1, GLI3, SEMA5A, and RPS3AP5 (Fig. 5A). Visual analysis of the lactylation modification peaks of the five genes revealed that the lactylation peak signal intensity was stronger after lactate treatment (Fig. 5B). These findings suggeste that COL27A1, SLFNL1, GLI3, SEMA5A, and RPS3AP5 are key genes that exhibit high histone lactylation modification in macrophages.
Histone lactylation-mediated GLI3 induces macrophage M1 polarization
To further identify macrophage polarization-related genes regulated by histone lactylation, we validated the expression of the candidate genes. Notably, RPS3AP5 was excluded from analysis as its transcript could not be identified in the NCBI database. RT-qPCR analysis revealed that COL27A1 expression was significantly downregulated following lactate treatment, while SLFNL1 and SEMA5A showed no significant changes (Fig. 6A). Importantly, GLI3 expression was markedly upregulated, which is consistent with the transcriptome sequencing results (Fig. 6A). Additionally, CUT&Tag profiling identified lactylation-modified loci in the intronic sequences of the GLI3 gene. GLI3 is a crucial transcription factor in the Hedgehog pathway, which has been implicated in the regulation of macrophage polarization [16,17,18]. Therefore, we selected GLI3 for further investigation. Macrophages were treated with lactate, and ChIP-qPCR was performed using an H3K18la-specific antibody to assess the histone lactylation status associated with GLI3. Compared with the NC group, lactate treatment significantly enhanced histone lactylation at the GLI3 region (Fig. 6B). To further confirm the regulatory effect of lactate on GLI3 lactylation, a luciferase reporter assay was conducted using constructs containing either the wild-type GLI3 (GLI3-WT) or a mutant lacking the H3K18la modification site (GLI3-MUT). Lactate treatment significantly increased luciferase activity in the GLI3-WT group, while no such effect was observed in the GLI3-MUT group (Fig. 6C). Moreover, IF (H3K18la antibody) combined with FISH (GLI3 DNA probe) demonstrated colocalization of H3K18la and GLI3 DNA in macrophages (Fig. 6D). These findings indicate that lactate upregulates GLI3 expression in macrophages through H3K18la-mediated transcriptional activation.
To clarify the impact of GLI3 on macrophage M1 polarization, we knocked down GLI3 in macrophages and incubated them with lactate. Compared to the control group, all three siRNA knockdown groups showed a significant decrease in GLI3 expression (Fig. 6E). WB results also demonstrated a significant knockdown efficiency of GLI3 (Fig. 6F, G). Then, we examined the levels of macrophage polarization markers and found that knockdown of GLI3 significantly downregulated the M1 markers iNOS, MCP-1, and CD80 (Fig. 6H). The M2 marker MRC-2 was significantly downregulated, while CD163 and Arg-1 showed no significant changes (Fig. 6I). ELISA results indicated that GLI3 knockdown resulted in a decrease of TNF-α and IL-1β, and a significant increase of IL-10 (Fig. 6J). The IF results indicated that knockdown of GLI3 reduced CD86 expression (Fig. 6K) and increased CD206 expression (Fig. 6L). These findings suggeste that knockdown of GLI3 hinders the macrophage polarization towards the M1 phenotype.
Lactate induces macrophage M1 polarization via GLI3
To validate the impact of lactate on promoting M1 polarization of macrophages through inducing GLI3 expression, we conducted rescue experiments. ELISA analysis of inflammatory cytokine levels showed that GLI3 knockdown significantly reversed the lactate-mediated upregulation of TNF-α and IL-1β, as well as the downregulation of IL-10 (Fig. 7A). IF results revealed that knockdown of GLI3 partially counteracted the lactate-induced upregulation of CD86 and downregulation of CD206 (Fig. 7B, C). These findings indicate that lactate promotes macrophage M1 polarization through a GLI3-dependent mechanism.
Exosomes derived from lactate-treated M1 macrophages induce functional impairment of vascular endothelial cells
M1 macrophage-mediated inflammatory response is a key factor leading to endothelial cell dysfunction, which is an early pathological event in the formation of AAA [19, 20]. However, the effects of lactate-induced M1 macrophages on endothelial cell dysfunction remain unclear. To investigate whether lactate-induced M1 macrophages regulate endothelial cell function, we co-cultured macrophages with HUVEC after lactate treatment. The CCK-8 revealed that the co-culture of lactate-treated macrophages with HUVEC inhibited the viability of HUVEC compared to the control group (Fig. 8A). The expression of endothelial dysfunction markers VCAM1, MMP9, and NOX1 in the lactate-treated group was significantly elevated, as indicated by the RT-qPCR (Fig. 8B). Furthermore, we assessed the impact of lactate-treated macrophages on the tube formation capacity of HUVEC. Angiogenesis is critical for vascular repair, and its impairment exacerbates endothelial dysfunction in AAA pathogenesis [21]. We found that lactate-induced M1 macrophages significantly suppressed the tube formation ability of HUVEC (Fig. 8C). These results suggest that lactate-induced M1 macrophages induce functional impairment of vascular endothelial cells.
Next, we investigated the molecular mechanisms underlying the crosstalk between M1 macrophages and endothelial cells. Based on established evidence that macrophage-derived exosomes regulate endothelial function [22], we hypothesized whether exosomal communication mediates endothelial dysfunction induced by lactate-polarized M1 macrophages. Therefore, exosomes derived from lactate-treated macrophages were extracted and used to incubate HUVECs. TEM confirmed the characteristic cup-shaped morphology of the isolated exosomes (Fig. 8D). WB analysis demonstrated significant enrichment of exosomal markers, including Alix, TSG101, CD9, and CD63, in the exosome fraction compared to whole macrophage lysates (Fig. 8E). CCK-8 results demonstrated that exosomes isolated from lactate-treated macrophages significantly suppressed HUVEC proliferation compared with exosomes in the control group (Fig. 8F) and upregulated key pathological markers VCAM1, MMP9, and NOX1 (Fig. 8G). Functional assessment revealed that HUVECs incubated with exosomes derived from lactate-treated macrophages exhibited substantial impairment of tube formation capacity (Fig. 8H). These results suggest that exosomes secreted by M1 macrophages induce endothelial dysfunction.
Exosomal SERPINE1 from M1 macrophages mediates endothelial dysfunction
To further elucidate the molecular mechanism by which M1 macrophage-derived exosomes induce endothelial dysfunction, we isolated exosomes from both control and lactate-polarized M1 macrophages and performed mass spectrometry analysis. Combining the results of mass spectrometry with a review of the literature, we screened SERPINE1 protein, which was upregulated in the lactate group and inhibited angiogenesis, for further investigation (Fig. 9A). WB analysis confirmed its significant upregulation in M1 macrophage-derived exosomes (Fig. 9B). To assess the functional role of SERPINE1 in endothelial cells, we performed SERPINE1 knockdown in HUVECs (Fig. 9C). Flow cytometry and CCK-8 results revealed that SERPINE1 silencing markedly reduced apoptosis (Fig. 9D) and enhanced proliferation (Fig. 9E), respectively. RT-qPCR demonstrated that SERPINE1 knockdown significantly downregulated endothelial dysfunction markers, including VCAM1, MMP9, and NOX1 (Fig. 9F). Furthermore, IF staining indicated elevated VE-cadherin expression following SERPINE1 knockdown, suggesting improved endothelial barrier integrity (Fig. 9G). These findings demonstrate that M1-polarized macrophages promote endothelial dysfunction via exosomal SERPINE1.